Trumpa genomo istorija  (9)

GTGCCAGCAGCCGCGGTAATTCCAGCTCCAATA GCGTATATTAAAGTTGCTGCAGTTAAAAAG Atrodo lyg beprasmis raidžių kratinys, tačiau ši DNR seka yra išties nuostabi. Ji yra visose ląstelėse – jūsų kūno, jūsų katino ar šuns, žuvies jūsų lėkštėje, bičių ir drugelių sode ir bakterijų pilve. Iš tiesų, kur berastume gyvybę Žemėje – nuo verdančio vandens versmių vandenyno dugne iki sušalusių bakterijų aukštai skriejančiuose debesyse, atrasite ir šią seką. Ją galite aptikti netgi dariniuose, kurie nelaikomi gyvais, pavyzdžiui didžiuliuose virusuose, vadinamuose mimivirusais.

Ši seka yra taip paplitusi, nes evoliucionavo iš visų gyvybės formų bendro protėvio ir kadangi vykdo svarbų procesą, nuo to laiko nepasikeitė. Kitaip tariant, kai kurios jūsų DNR dalys yra neįsivaizduojamų 3 milijardų metų amžiaus, perduotos nenutrūkstančia trilijonų protėvių grandine.

Kitos jūsų DNR dalys gana naujos. Genome turite maždaug 100 mutacijų, kurių neturi jūsų motina ar tėvas, – nuo vienos ar dviejų kodo raidžių skirtumo iki didžiulių DNR gabalų gavimo ar praradimo.

Nustatyti, kurios DNR atkarpos yra naujos, kurios – senos, galime, lygindami genomus. Pavyzdžiui, lyginant jūsų genomą su brolių ar seserų, galima nustatyti naujas mutacijas. Žmonių ir gyvūnų genomo palyginimas atskleidžia daug senesnius pokyčius.

Tačiau mūsų genomai nėra vien žmonių gamybos receptai. Tai gyvi istoriniai įrašai. O, kadangi mūsų genomai tokie didžiuliai, sudaryti iš daugiau, nei 6 milijardų DNR raidžių – surašius jas visas, išeitų dešimčių metrų aukščio knygų krūva – mūsų praeitis juose užfiksuota itin detaliai. Tai leidžia atsekti mūsų evoliuciją nuo gyvybės aušros iki pat šių dienų.

Nors šiuos įrašus dar tik pradedame dešifruoti, jau išsiaiškinome, kad mūsų protėviams už išlikimą teko kovoti ne tik dantimis ir nagais. Įnirtingi mūšiai vyko ir mūsų genomuose. Šie mūšiai pakeitė genomų veikimą ir galiausiai padarė mus tokiais, kokie esame.

Bendras protėvis

Pradžioje buvo RNR. Ši daug talentų turinti molekulė gali saugoti informaciją ir katalizuoti reakcijas, o tai reiškia, kad kai kurios RNR gali save replikuoti. Vos tik viena RNR molekulė ar molekulių rinkinys ėmė save replikuoti, gimė pirmasis genomas.

Deja, RNR nėra itin stabili, tad gyvybė labai anksti persijungė prie informacijos saugojimo molekulėje, kurios šiek tiek kitoks cheminis karkasas taip lengvai netrūkinėdavo – DNR. Baltymai pakeitė RNR kaip katalizatorių, palikdami jai tarpininko vaidmenį. DNR saugojo baltymų gamybos receptus ir siųsdavo jų RNR kopijas baltymų gamybos aparatui.

Daug senojo, RNR valdomo pasaulio pėdsakų likę mūsų genome. Pavyzdžiui, straipsnio pradžioje parašyta visur esanti seka koduoja dalį RNR fermento, tebevaidinančio svarbų vaidmenį baltymų sintezėje.

žodynas

Archėjai
viena iš dviejų vienaląsčių organizmų rūšių
Bakterijos
viena iš dviejų vienaląsčių organizmų rūšių
Eukariotas
sudėtinga ląstelė su būdinga vidine struktūra
Eksonas
viena iš koduojančių baltymą geno dalių
Genas
baltymo ar funkcinės RNR kūrimo receptas
Intronas
geno dalis, nekoduojanti baltymo. Intronai paprastai būna iškerpami iš geno RNR kopijos prieš šiai pasiekiant baltymo gamybos vietą
LUCA
Paskutinis visuotinis bendras protėvis (Last Universal Common Ancestor)
Splaisingas
intronų šalinimo iš RNR procesas
Transpozonas
genetinis parazitas. Jame yra fermentų kodas, leidžiantis kopijuoti ir įterpti save į kitas genomo dalis

Maždaug prieš 3,5 milijardus metų išsivystė gyvybės forma, turinti RNR ir baltymų gamybos receptų genomą – paskutinysis visuotinis bendras visos gyvybės protėvis (the Last Universal Common Ancestor – LUCA). Mažiausiai 100 genų galima užtikrintai atsekti iki LUCA, tvirtina Eugene'as Kooninas iš Nacionalinio sveikatos instituto Bethesda'oje, Merilende, studijuojantis gyvybės evoliuciją, ir LUCA tikriausiai iš viso turėjo daugiau, nei 1000 genų.

LUCA turėjo daug esminių funkcijų, randamų ir visoje dabartinėje gyvybėje, tarp kurių ir baltymų gamyba. Tačiau tai galėjo būti gyvybė, gana nepanaši į dabartinę. Kai kurie tyrėjai mano, kad LUCA visai nebuvo atskira, membranos ribojama ląstelė, o veikiau į virusus panašių elementų besidauginanti visuma kažkokioje negyvoje erdvėje, pavyzdžiui, šarminių hidroterminių šaltinių porose.

Skilimas ir susijungimas

Pagal vieną tikėtiną scenarijų, kitoje stadijoje LUCA'os į virusus panašūs elementai du atskirus kartus suskilo, įgaudami ląstelių membraną ir tapdami paprastomis ląstelėmis. Tai paaiškintų, kodėl yra dvi vienaląsčių rūšys – bakterijos ir archėjai –, turinčios visiškai skirtingą ląstelių membraną. „Tai labai patraukli hipotezė,“ sako Kooninas. Bet neabejojama, kad gyvybės skilimas į dvi pagrindines šakas įvyko labai anksti.

Bakterijos ir archėjai išvystė stulbinančius molekulinius mechanizmus ir pakeitė planetą, bet tebebuvo nedaug daugiau, nei mažyčiai chemikalų maišeliai. Tai tęsėsi, kol nepaprastas įvykis sujungė dvi šakas iš naujo ir atsirado sudėtingos ląstelės, kitaip – eukariotai. Šis įvykis pakeitė genomą ir nutiesė kelią pirmųjų gyvūnų evoliucijai.

Maždaug prieš milijardą metų bakterija atsidūrė archėjo viduje. Užuot vienas kitą nužudę, jie sukūrė simbiotinius santykius, kur bakterijų palikuoniai palaipsniui prisitaikė atlikti svarbų vaidmenį: jie tapo mitochondrijomis, ląstelių energijos fabrikais.

Be šios sąjungos sudėtinga gyvybė tikriausiai nebūtų išsivysčiusi visai. Mes linkę manyti, kad paprastiems organizmams natūralu vystytis į sudėtingesnius, bet atskiros bakterijos ir archėjai niekada neišsivystė labiau, nei tam tikras sudėtingumo lygis. Kodėl?

Pasak Nicko Lane'o iš UCL, taip yra dėl energijos barjero. Visi paprasti organizmai kuria energiją ląstelės membrana. Joms augant, mažėja paviršiaus ploto santykis su tūriu, tad tampa sunkiau pasigaminti pakankamai energijos. Dėl to vienaląsčiai turi likti maži, o mažose ląstelėse neužtenka vietos dideliam genomui. Mitochondrijos pašalino šį barjerą, sukurdamos modulinį energijos šaltinį. Dabar ląstelės galėjo augti, paprasčiausiai gamindamos daugiau mitochondrijų, o tai leido joms plėsti genomą ir tuo pačiu – saugoti daugiau informacijos.

Nepaisant akivaizdaus pranašumo, šios sandraugos sudarymas buvo kupinas pavojų. Konkrečiau, protėvinių mitochondrijų genomas buvo užkrėstas parazitinės DNR gabalais, kitaip – transpozonais, kurie nieko neveikė, tik kūrė savo kopijas. Kartais jie atsidurdavo genų viduryje, palikdami ten didelius nesusijusios DNR gabalus, – intronus. Tai tas pats, lyg įklijuoti sriubos receptą į pyrago receptą.

Tačiau rezultatas ne visada būdavo nelaimės receptas, nes šie intronai buvo „saviskaldžiai“: po to, kai buvo padaroma geno RNR kopija – pirmasis baltymų kūrimo proceso žingsnis – jie patys atsiskirdavo. Tačiau taip atsitikdavo ne visada, tad jie kenkdavo. Daugumos bakterijų genuose intronų nėra, nes didelėse populiacijose, kur stipri konkurencija, stipri natūralioji atranka juos išravi. Bet protėvinių eukariotų populiacija buvo labai maža, tad atranka buvo silpna. Genetiniai parazitai, atklydę kartu su mitochondrijų protėviais, pradėjo replikuotis kaip pašėlę, pagrindinį genomą užteršdami šimtais intronų.

Dabar kiekviename mūsų gene yra maždaug aštuoni intronai, daugelis kurių mena pačius pirmuosius eukariotus – mūsų pirmtakai taip ir nesugebėjo jais atsikratyti. Vietoje to, sukūrė atsikratymo būdus, pakeitusius mūsų genų struktūrą ir ląstelių dauginimąsi. Vienas tų būdų buvo lytis.

Sekso privalumai

Kertinis lytinio dauginimosi aspektas yra ne vien skirtingų individų genų sumaišymas, svarbus dėl evoliucinių pranašumų, atsiradusių skirtingose genų linijose, apjungimo – paprastos ląstelės seniausiai mainydavosi genais, neapsunkindamos savęs seksu. Tai yra ir rekombinacijos procesas, kai chromosomų poros, prieš pasidalindamos į spermą ar kiaušinėlius, apsikeičia atitinkamais kodo gabalais. Rekombinacija padeda išspręsti fundamentalią problemą, kai genomas susideda iš daugelio genų, susijusių, kaip rutuliukai ant vėrinio.

Įsivaizduokite vėrinį, kurioje tikrai nuostabaus grožio perlas yra šalia netikusio. Jei negalima pakeisti perlo kitu, tenka atsikratyti viso vėrinio arba naudoti tokį vėrinį, koks yra. Panašiai yra ir genuose. Jei naudinga mutacija atsiduria šalia kenksmingos, tai arba naudinga mutacija bus prarasta, arba kenksmingoji paplis populiacijoje, traukiama savo kaimynės.

Rekombinacija suteikia galimybę pakeisti perlus. Lygiai, kaip galite padaryti vieną tobulą vėrinį ir vieną – su defektais, taip ir kai kurios atžalos turės neproporcingai daug gerų genų, tuo tarpu kitos – blogų, galbūt su trukdančias intronais. Nesėkmingieji individai tikriausiai išmirs, o su gerais genais – klestės.

Didelėse populiacijose vyksta tiek daug mutacijų, kad kai kurios priešinasi žalingo geno veikimui, tad nėra reikalo griebtis rekombinacijos. Bet mažose populiacijose seksas naudingas. Todėl tai tapo norma pirmiesiems eukariotams ir taip – daugumai jų palikuonių. Tad kitą kartą mylėdamiesi galite geru žodžiu paminėti genetinius parazitus, susigriebtus senovinių bakterinių protėvių.

Už sekso džiaugsmus galite padėkoti genetiniams parazitams, susigriebtiems mūsų bakterinių protėvių

Seksui išsivysčius, buvo jau pernelyg daug intronų, kad būtų įmanoma jų visų atsikratyti. Ankstyviesiems eukariotams greitai iškilo kita rimta problema: intronuose kaupiantis mutacijoms, savaiminio atsiskyrimo mechanizmas pradėjo strigti. Tad ankstyviesiems eukariotams išsivystė specialūs mechanizmai – splaisosomos, – gebantys iškirpti intronus iš geno RNR kopijų.

Splaisosomos yra kvailas sprendimas, būdingas evoliucijai: valyti geno RNR kopijas, užuot pašalinus šiukšles tiesiogiai iš DNR, – labai neefektyvu. O be to, splaisosomos yra lėtos. Daug RNR pasiekia baltymų gamyklas dar prieš tai, kai iš jų pašalinami intronai, tad, susidaro daug baltymų su defektais.

Kooninas spėja, kad tai buvo priežastis, paskatinusi branduolio išsivystymą. Kai ląstelės DNR buvo atskirta nuo baltymų gamybos mechanizmo, būdavo išleidžiamos tik apvalytos RNR, tad ląstelei nebereikėdavo švaistyti energijos, gaminant bereikalingus baltymus.

Tačiau netgi tai neišsprendė visų problemų. Splaisosomos per klaidą dažnai iškirpdavo koduojančias geno dalis – eksonus, tad susidarydavo mutavusios baltymo versijos. „Alternatyvus splaisingas nebuvo prisitaikymas,“ sako Kooninas. „Tai buvo kažkas, su kuo organizmai turėjo susitaikyti.“

Tad mūsų senoviniams protėviams žingsnis po žingsnio išsivystęs daugiasluoksnis mechanizmas, turėjęs susitvarkyti su intronų plitimu, vis tiek negalėjo išspręsti visų jų sukeltų problemų. Bet kitaip, nei paprastos ląstelės, jie galėjo sau leisti tokį švaistūniškumą, kadangi turėjo energijos, o ilgainiui visas šis perdėtas sudėtingumas suteikė naujas galimybes.

Įvairialypiškumas ir kontrolė

Dėl intronų ir dėl to – eksonų, genai iš esmės pasidarė moduliniai. Nepertrūkstamame gene sekas pridedančios ar pašalinančios mutacijos paprastai pakeičia ir likusio geno nuskaitymo tvarką, tad gaunasi beprasmė maišalynė. O tuo tarpu eksonai gali persikelti, nesutrikdydami geno likučio. Genai galėjo vystytis, perstumdydami eksonus ir jais keisdamiesi.

Tarkime, atsitiktinė mutacija prie geno prideda papildomą eksoną. Dėl alternatyvaus splaisingo, originalioji geno versija vis tiek gali būti gaminama, bet kartu sukuriamas dar ir naujas baltymas (žr. „Pjaustykla“). Mutacija gali turėti nežymų poveikį, tad atranka jos neeliminuos, bet laikui bėgant, naujasis baltymas gali įgyti naują funkciją. Taip atsitiktinai eukariotų neprotingos pastangos susitvarkyti su intronais padarė jų genus daugiatiksliais ir labiau prisitaikančiais.

Jei šis požiūris į sudėtingų ląstelių evoliuciją teisingas, daugelis svarbiausių mūsų genomo savybių, nuo modulinių genų iki sekso, išsivystė kaip tiesioginė parazitų turinčių mitochondrijų gavimo pasekmė. Alternatyvių idėjų paneigti negalima, bet nė viena jų nepateikia tokio gražaus paaiškinimo. „Tai mano mėgstamiausias scenarijus,“ sako Kooninas.

Visos šios naujos savybės sukėlė evoliucinių inovacijų pliūpsnį, eukariotai klestėjo ir greitai pradėjo diversifikuotis. Tačiau jie vis tiek susidurdavo su nenuilstančia naujų rūšių parazitinių DNR ir virusų ataka. Tačiau, peržengusios paprastų ląstelių dydžio apribojimus, sudėtingos ląstelės galėjo vystyti sudėtingesnius gynybos mechanizmus.

Galima „nutildyti“ transpozonų parazitinius genus, prie DNR pridedant žymeklius, stabdančius RNR kopijų gaminimą – šis procesas vadinasi metiliavimas. Kitas gynybos nuo besiskverbiančių virusų būdas yra jų RNR sunaikinimas, taip neleidžiant jiems dalintis. Šios gynybos taktikos buvo sėkmingos tik iš dalies. Dabar maždaug 5 % žmogaus genomo yra mutavusios ir dažniausiai inertiškos virusų liekanos, o stulbinančius 50 % sudaro transpozonų likučiai, kurie yra kaip atminimas apie daugybę kartų, kai šiems parazitams kažkaip pavykdavo pakliūti į mūsų protėvių genomus ir netrukdomiems veikti.

Toks apsaugos mechanizmas greitai buvo pajungtas kitam tikslui: pačios ląstelės genų aktyvumo kontrolei. „Transpozonų kontrolės mechanizmai tapo genų kontrolės mechanizmais,“ apibendrina Ryanas Gregory'is iš Guelpho universiteto Kanadoje, studijuojantis genomų evoliuciją.

Kūnų statyba

Ląstelėms pradėjus bendradarbiauti artimiau, nei bet kada, maždaug prieš 800 milijonų metų, scena buvo paruošta kitam dideliam evoliucijos žingsniui. Nors keletas bakterijų yra daugialąstės, tačiau toliau eiti šiuo keliu vis neleido jų sudėtingumo apribojimai. Tuo tarpu eukariotai daugialąstiškumą išvystė ne kartą, pradėdami daug ypač sudėtingų organizmų linijų – grybų, jūržolių, sausumos augalų ir, žinoma, gyvūnų.

Viena iš priežasčių buvo didesnis genų repertuaras, kuris galėjo būti pasitelktas naujiems tikslams, tarkim, ląstelių susijungimui ir tarpusavio komunikavimui. O dar svarbiau, kad modulinė jų genų prigimtis leido spartesnę evoliuciją. Pavyzdžiui, ląsteles kartu jungiantys baltymai susideda iš ląstelės membraną supančios dalies ir į išorę išsikišusios dalies. Dėl modulinių genų, įvairiausios išorinės dalys gali būti pritaikytos membraną supančiai daliai, kaip skirtingi antgaliai dulkių siurbliui. Daugelis daugialąstiškumui svarbių genų išsivystė per eksonų maišymą.

Be to, sudėtingesnis eukariotų genų kontrolės mechanizmas galėjo būti panaudotas ląstelių specializavimuisi. Įjungiant ir išjungiant skirtingas genų sekas, skirtingos ląstelių grupės galėjo vaidinti skirtingus vaidmenis. Dėl to organizmai galėjo pradėti vystyti skirtingus audinius, leidusius ankstyviesiems gyvūnams evoliucionuoti iš paprastų kempines primenančių sutvėrimų į vis sudėtingesnę kūno sandarą turinčius gyvūnus.

Kitas šuolis įvyko dėl poros genetinių atsitiktinumų. Kai dauginantis reikalai vyksta ne taip, kaip derėtų, kartais visas genomas duplikuojasi – taip nutiko ir ne kartą, o du visų stuburinių gyvūnų protėviui. Šie genomo dublikatai suteikė daug papildomų genų kopijų. Daugelis jų buvo prarasti, tačiau kiti pakeitė paskirtį. O būtent, duplikavimas sukūrė keturias genų sankaupas, vadovaujančias kūno plano išdėstymui vystantis – Hox genus – ir manoma, kad šios sankaupos vaidino svarbų vaidmenį, vystantis vidiniam skeletui. Nors viso genomo duplikavimas yra retas, daugelis naujų genų atsiranda dėl mažesnių duplikavimųsi ar dėl eksonų maišos arba dėl abiejų šių faktorių. Evoliucija yra begėdė – ji išnaudoja bet kokią DNR, duodančią kokią nors naudą, ir nesvarbu, iš kur ji paimta. Kai kurie svarbūs genai išsivystė iš DNR atliekų, tuo tarpu kiti buvo pačiupti iš kitur. Pavyzdžiui, maždaug prieš 500 milijonų metų į mūsų protėvių genomą įsibrovė genetinis parazitas, vadinamasis hAT transpozonas, kopijuojantis save „iškirpk ir padėk“ metodu. Karpymas atliekamas dviem fermentais, prisitvirtinusiais prie tam tikrų DNR sekų. Kažkuriuo metu pirmuosiuose stuburiniuose šios DNR karpymo fermentų sekos atsidūrė šalia geno (arba jame pačiame), susijusio su besibraunančių bakterijų ir virusų atpažinimu. Dėl to organizme dalinantis ląstelėms, hAT iškarpė geno dalis. Svarbiausia, skirtingose genų linijose buvo iškarpyti skirtingi gabaliukai – atsirado daug mutavusių baltymo versijų. Kai kuriais atvejais tai buvo gyvybę gelbstintis pokytis, nes mutavę genai geriau prisitvirtindavo prie įsibrovusių patogenų. Greitai išsivystė mechanizmas, skirtas efektyviausius baltymus gaminančių ląstelių atpažinimui ir jų dauginimosi skatinimui – prisitaikanti imuninė sistema. Žmogaus imuninė sistema dabar yra beprotiškai sudėtinga, tačiau du fermentai, karpantys ir perstumdantys genus – tai būtinos kovos su įsibrovėliais priemonės – yra tiesioginiai hAT fermento palikuoniai . Tad reikia dėkoti senoviniam parazitui už mūsų efektyviausią ginklą prieš ligas.

Žmogaus genomas

Apsiginklavę tokia pažangia gynyba ir turėdami genetinius įrankius, galinčius suteikti tokią įvairią kūno formą, pirmieji stuburiniai buvo labai sėkmingi. Jie užkariavo jūras, kolonizavo sausumą, įsiropštė į medžius, o tada nulipo žemyn ir pradėjo vaikščioti dviem kojomis.

Kodėl mes taip skiriamės nuo kitų beždžionių? Tarp mūsų yra vienas, regis, didelis skirtumas: mes turime 23 chromosomas, o ne 24, kaip mūsų beždžioninis protėvis. Bet chromosomos iš esmės tėra maišai su genais ir nėra didelio skirtumo ar jie išsibarstę plačiau, ar glaudžiau, jei tik yra visi reikalingi genai. Tad, panašu, daug mažų pokyčių pamažu pakeitė mūsų smegenis ir kūnus. Kai kurias mutacijas jau atsekėme, bet jų gali būti daug tūkstančių.

Žvelgiant atgal, aiškėja, kad ląstelių ir kūnų sudėtingumas prasidėjo, išaugus genomo sudėtingumui. Tačiau stebina tai, kad daugelis šių sudėtingumo padidėjimų įvyko ne dėl evoliucinės atrankos, o dėl jos trūkumo. „Didžioji dalis genome vykstančių pokyčių tikriausiai yra neutralūs,“ sako Gregory'is.

Kitais žodžiais tariant, kyla mutacijos, darančios mažą poveikį, – jei išvis kokį nors –, pavyzdžiui, genų duplikavimasis. Didelėje populiacijoje tokie pokyčiai būtų greitai prarasti. Bet mažoje populiacijoje jie gali plisti atsitiktinai, per genų dreifą. „Tai neišvengiama populiacijų genetikos pasekmė,“ paaiškina Kooninas. Toks sudėtingumas atrenkamas vėliau, pavyzdžiui, genui gavus naują paskirtį.

Daug svarbių mūsų istorijos momentų, kaip genomo duplikavimasis, sukūręs mūsų Hox genus, gali būti kilę dėl silpnos atrankos mažose populiacijose. Išties, tokie populiacijų „butelio kakliukai“ pačioje žmonių evoliucijos pradžioje gali paaiškinti paplitimą kai kurių mutacijų, skiriančių mus nuo beždžionių, tarkime, raumenų jėgos sumenkimą.

Kitas nuostabus dalykas, tai didžiulis virusų ir parazitų vaidmuo. Daugelis pagrindinių mūsų genomo savybių, nuo lyties iki metiliavimo, išsivystė kaip atsakas į jų atakas. Dar daugiau, nemažai mūsų genų ir eksonų, pavyzdžiui, imuniteto fermentai, kilo tiesiogiai iš šių užpuolikų. „Virusai buvo būtina ląstelinės gyvybės dalis nuo pat pradžios,“ pažymi Kooninas.

Būtina, bet ne maloni. Mūsų evoliucijos kaštai didžiuliai. Sakoma, istoriją rašo nugalėtojai – ką gi, mūsų genomas yra pergalių, pavykusių eksperimentų (ar bent jau nenužudžiusių mūsų protėvių), metraštis. Esame ilgos loterijos laimėtojų linijos palikuonys, loterijos, kurios prizas – atžalos, išgyvenančios pakankamai ilgai, kad susilauktų savo palikuonių. Šiame žaidime buvo nesuskaičiuojama daugybė nesėkmių, kai trilijonai gyvūnų žūdavo dažnai siaubingomis mirtimis.

Sakoma, istoriją rašo nugalėtojai. Mūsų genomas yra pergalių ir sėkmingų eksperimentų metraštis

Mūsų genomas toli gražu nėra nudailintas, baigtas produktas. Veikiau jau grubiai sudurstytas iš genetinių avarijų nuolaužų ir senovinių parazitų liekanų. Tai rezultatas beprotiško, nekontroliuojamo eksperimento, kurį nesvarstydama atmestų bet kokia etikos taryba. Šis procesas tęsiasi ir dabar – nuvykite į bet kurią ligoninę ir tikriausiai išvysite vaikus, mirštančius nuo siaubingų genetinių ligų. Bet miršta ne tiek daug, kiek mirdavo anksčiau. Tarkime, per embrionų patikrą pradedame kontroliuoti žmogaus genomo evoliuciją. Brėkšta nauja aušra.


Michael Le Page yra New Scientist biologijos skyriaus redaktorius.

New Scientist № 2882

Aut. teisės: www.technologijos.lt

(5)
(0)
(4)

Komentarai (9)